Biología 2º de Bachillerato

4 horas lectivas a la semana

Correo de contacto PARA ALUMNOS: francisco.bueno.edu@juntadeandalucia.es NO FUNCIONA

NUEVO correo de contacto PARA ALUMNOS: pacorobinia@gmail.com

¡Hola a todos!

Como sabeis todos los temas y activides del curso están en mi página web (apartado cursos)

El último día de clase en el aula terminabos la unidad didáctica 14 "Las bacterias y su papel en la Biosfera".

Estas semanas teneís que hacer lo siguiente (Cualquier actividad se entregará en formato WORD o PDF)

 

Semana 16 marzo-22 marzo Resolver las siguientes actividades de la unidad didáctica 14.

Enviarlas el día 22 de marzo

  1. Describe la organización celular de una bacteria.

  2. Clasifique los tipos de bacterias en función de la fuente de energía y del carbono que utilizan y justifique la respuesta.

  3. Suponga que desaparecieran todas las bacterias de la Tierra. Proponga de manera razonada cuatro argumentos que pongan de manifiesto el perjuicio que provocaría esta desaparición.

  4. Los seres vivos aparecieron sobre la Tierra hace, aproximadamente, 3.500 millones de años. ¿Por qué los cadáveres de casi todos los seres vivos han desaparecido? Dé una explicación a este hecho y justifique la necesidad de que ocurra.

  5. Los mamíferos contienen una flora bacteriana intestinal beneficiosa ¿por qué? Sin embargo cuando se realiza un tratamiento prolongado con antibióticos pueden aparecer bacterias patógenas ¿por qué?

  6. Explique el concepto de microorganismo. Realice una clasificación de los principales grupos de microorganismos indicando los criterios utilizados para ello. Exponga dos características importantes que permitan distinguir a cada grupo.

  7. Exponga cuatro características que permitan definir los siguientes tipos de microorganismos: algas, hongos y protozoos. Cite cuatro diferencias que puedan establecerse entre estos microorganismos y los procariotas.

  8. Con respecto a la pared celular de las bacterias, ¿cuál de los dos tipos de bacterias (Gram positivas y Gram negativas) crees que tiene más ventajas frente a antibióticos como la penicilina? ¿Por qué?

  9. ¿Qué diferencias hay entre bacterias F- y bacterias F+? ¿Qué implicaciones parasexuales tienen estas diferencias?

  10. Indica las diferencias entre conjugación, transformación y transducción.

  11. Realizar un esquema del ciclo del nitrógeno indicando los microorganismos que participan en el mismo.

  12. Realiza un cuadro en el que figuren los productos industriales, medicinales y alimenticios obtenidos con ayuda de los microorganismos.

  13. Cuando se manipulan cultivos se suele utilizar el asa de cultivo o aguja de siembra. En el proceso se calienta el asa de cultivo hasta la incandescencia, y la transferencia de microorganismos de un medio a otro, se hace siempre en la proximidad de la llama de un mechero. ¿Qué explicación puedes dar a este hecho?

  14. ¿Qué proceso metabólico se produce en la elaboración del vino y la cerveza? ¿Qué tipo de microorganismo participa? ¿Y en la elaboración del yogur y otros derivados lácteos?

  15. Algunos microorganismos viven en simbiosis con otros seres vivos; otros son comensales o parásitos. Explica en qué consiste este tipo de relaciones y pon varios ejemplos de cada una.

  16. Indica los medios por los que se puede transmitir una enfermedad infecciosa, indicando en cada caso ejemplos concretos y el microorganismo implicado.

  17. Explica cuatro diferencias entre las células procarióticas y las eucarióticas.

  18. Enumera las razones que justifican el origen procariota de mitocondrias y cloroplastos.

  19. Analizar las semejanzas que existen entre mitocondrias y cloroplastos con bacterias, y sus implicaciones evolutivas.

  20. Explicar mediante esquema la evolución de los diferentes tipos de células a partir de lasprimeras células que se originaron en nuestro planeta. evolutivas.


    Semana 23 marzo-29 marzo (Realizar las actividades de repaso siguientes):

    Enviarlas el día 29 de marzo


    De la unidad 10 (EL METABOLISMO, LOS PROCESOS CATABÓLICOS: RESPIRACIÓN Y FERMENTACIÓN)

    1. Calcula cuántas moléculas de ATP se forman cuando 200 electrones son transportados por la cadena respiratoria desde el NADH hasta el O2.       

    2. Calcula cuántas moléculas de O2 son necesarias para oxidar 3 FADH2.

    3. Calcula cuántas moléculas de ATP se forman cuando se oxidan 100 moléculas de NADH, 50 moléculas de piruvato, 40 de acetil CoA.

    4. ¿Pueden sintetizarse ATP si se crea un gradiente artificial de pH entre mitocondrias y medio externo? No existe ningún combustible. 

    5. Si la energía requerida para la formación del ATP, en condiciones fisiológicas estándar es de 7300 cal/mol y 688000 cal/mol son las disponibles teóricamente en un mol de glucosa, calcule la eficacia (rendimiento energético) de la respiración aeróbica de la glucosa.

    6. ¿Qué diferencias existen entre la respiración nitrato y la respiración aeróbica?

    7. ¿Por qué la oxidación de un gramo de glucosa produce aproximadamente la mitad de energía que la oxidación de un gramo de ácido graso?

    8. En relación a los efectos del alcohol en las personas, responde con argumentos bioquímicos a las siguientes preguntas: a) ¿Estimula el alcohol el funcionamiento de la cadena respiratoria? ¿Y la glucolisis? ¿Y el Ciclo de Krebs? b) ¿Aumentan los depósitos de grasa de las células hepáticas en presencia de alcohol?

    9. Indicar en que se parecen y en qué se diferencian el metabolismo de los lípidos, el de los aminoácidos y el de los glúcidos.

    10. Analiza la siguiente afirmación: "El oxígeno consumido durante la oxidación de la glucosa en las células animales es devuelto a la atmósfera formando parte del CO2". ¿Cómo podría demostrarse la certeza o falsedad de esta afirmación?

     

    De la unidad 11 (FOTOSÍNTESIS Y QUIMIOSÍNTESIS)

    1. Las células vegetales tienen cloroplastos y mitocondrias. Teniendo en cuenta que los cloroplastos generan energía ¿para qué necesitan las mitocondrias? Razone la respuesta.

    2. ¿Por qué el Ciclo de Calvin sólo se produce durante el día?

    3. La fase oscura de la fotosíntesis puede realizarse en ausencia de luz. ¿Tiene algún límite la fijación del CO2 en esta situación? Razone la respuesta.

    4. Defina y diferencie los siguientes pares de conceptos referidos a los microorganismos: autótrofo/heterótrofo, quimiosintético/fotosintético; aerobio/anaerobio.

    5. ¿De dónde proceden los protones y electrones necesarios para la formación del NADPH en las plantas?

    6. ¿Qué ocurriría en la biosfera si en la fase luminosa de la fotosíntesis el dador de hidrógenos siempre fuera el SH2?

    7. ¿Cómo eran los primeros organismos fotosintéticos? ¿Cómo afectó la aparición de la fotosíntesis a nuestro planeta? ¿Qué cambios evolutivos desencadenó?

    8. Contesta a las siguientes preguntas referidas a la fotosíntesis: a) ¿Qué compuesto es el aceptor del dióxido de carbono en el ciclo de Calvin? b) ¿Cuáles son los productos finales de las reacciones lumínicas de las plantas? c) ¿De dónde procede la molécula de oxígeno que se desprende en la fotosíntesis?

    9. Algunas plantas poseen hojas que no son de color verde. ¿Pueden realizar estas hojas la fotosíntesis? Razona tu respuesta.

    10. Explicar cómo se automantienen los ecosistemas en las profundidades de las dorsales oceánicas.

     

    De la unidad 13 (GENÉTICA MOLECULAR)

    1. Exponga razonadamente si el ADN de una célula de la piel de un individuo contendrá la misma información genética que una célula del hígado. ¿Sintetizan las dos células las mismas proteínas? Razone las respuestas.

    2. Si se conociese la secuencia de aminoácidos de una proteína, ¿podría determinarse exactamente la secuencia de nucleótidos del ADN que la codifica? ¿Ha aportado el descubrimiento del código genético alguna evidencia a favor de la teoría que considera que todos los seres vivos tienen un origen común?  Razone ambas respuestas.

    3. Indique el significado de las siguientes afirmaciones: las dos hebras de una molécula de ADN son antiparalelas; la replicación del ADN es semiconservativa; la replicación del ADN es bidireccional; una de las cadenas del ADN se replica mediante fragmentos de Okazaki. Razone las respuestas. ¿Por qué la duplicación del ADN se realiza de forma continua en una cadena y discontinua en la otra?

    4. Teniendo en cuenta el código genético, indique una secuencia de ADN que codifique el péptido: Leu-Ala-Pro-Ser-Arg-Arg-Val. ¿Es posible que exista más de una secuencia de ADN para este mismo péptido? Razone la respuesta.

    5. Un fragmento génico tiene la siguiente secuencia: 3' AGGGCCAGATGAACGG 5'. ¿Cuántos aminoácidos tendrá el polipéptido que codifica? ¿Qué pasaría con la secuencia polipeptidica si una mutación provocase la pérdida del primer nucleótido (A)? ¿Y si la mutación suprimiese los tres primeros nucleótidos (AGG)? Razone las respuestas.

    6. Teniendo el ARNm indicado, determinar la secuencia de las dos hebras del fragmento de ADN ADN que ha originado dicho ARN. Indicar el péptido que se obtendría al traducirlo. 5´GAUUACAACGGGCAGCUCCCC 3´

    7. Dada la secuencia de la cadena de ADN 3´..ATGCTTAGACTGCAGT..5´ determinar con ayuda del código genético el péptido a que daría lugar.

    8. Explicar qué resultados hubieran obtenido Meselson y Stahl si la replicación del ADN fuese conservativa.

    9. ¿Cómo afectaría a la replicación del ADN añadir grandes cantidades de didesoxicitidina trifosfato (nucleótido similar al dCTP pero sin grupo hidroxilo en el carbono 3´)? ¿Por qué?

    10. Explica las diferencias que existen entre transcripción en eucariotas y en procariotas.

    11. ¿Cuántas proteínas diferentes, de Pm = 20.000, puede codificar una cadena de ADN de 120.000 nucleótidos? Suponer que el Pm medio de los aminoácidos es de 100.

    12. La secuencia de aminoácidos de una proteína de levadura y una proteína humana que desempeñan la misma función son idénticas en un 60%. Sin embargo, las correspondientes secuencias del ADN sólo son idénticas en un 40%. Justificar este diferente grado de identidad.

    13. ¿Qué papel juegan las hormonas lipídicas en el control de la expresión génica?


     

    Semana 30 marzo-5 abril + Semana Santa
    Tenéis que hacer los siguientes problemas y enviarlos antes del día 12 de abril.

    ¡¡¡Cambiamos el orden de los temas!!!!
    Estas dos semanas vamos con los problemas de Genética

    A) Introducción a la Genética


    (todo lo que hay que saber para resolver este tipo de problemas)
    Ver en mi canal YouTube Aula de Biología el video 1 CONCEPTOS DE GENÉTICA:
    https://www.youtube.com/watch?v=FtHU4T3ofcE&list=PLjP0qVi_bT4a1IKQIZWE1uxdBy-c-D6nP&index=40

     

    B) Problemas


    - Esto es todo lo que tenéis que saber, no más.
    - Os envío un libro de problemas de Genética que escribí para ESO y Bachillerato
    La complejidad de algunos problemas del libro es mayos que lo que se os exige. Por tanto sólo hacer lo que indico.
    - Indico el número del problema para que podáis encontrar fácilmente la solución.
    - Todos estos problemas y muchos más los he desarrollado en mi canal YouTube Aula de Biología. Así que si queréis podéis seguir escuchado mi voz:
    https://www.youtube.com/channel/UC6m-RYGpZ8wrua3EAqYTEow

     

    1. En uno de sus primeros experimentos, Mendel cruzó líneas puras de guisantes (Pisum sativum) que tenían semillas amarillas con líneas puras de guisantes que tenían semillas verdes y obtenía siempre los mismos resultados: todas las plantas resultantes (primera generación filial o F1) del cruzamiento de la generación parental (P) presentaban semillas amarillas.
    Representar el cruzamiento realizado por Mendel.

    3. La lana negra de los borregos se debe a un alelo recesivo (“b”), y la lana blanca a un alelo dominante “B”). Indicar cómo serían los genotipos y los fenotipos de la F1 y de la F2 de la descendencia entre un carnero de lana negra y una oveja homocigótica de lana blanca.

     5. La acondroplasia es una forma de enanismo debida a un crecimiento anormalmente pequeño de los huesos como consecuencia de la presencia de un determinado gen.
    Teniendo en cuenta que dos personas acondroplásicas tuvieron un hijo acondroplásico y un hijo normal, responder a las siguientes preguntas:
    a) ¿Es la acondroplasia un carácter dominante o recesivo? ¿Por qué?
    b) ¿Cuáles son los genotipos de los padres? ¿Y el de los hijos? Realizar el cruzamiento correspondiente.
    15. En el dondiego de noche los alelos que determinan que las flores sean rojas o blancas se expresan en heterocigosis produciendo flores rosas.
    Determinar el genotipo y el fenotipo de la F1 y de la F2 resultante de cruzar entre sí una planta de flores rojas con otra de flores blancas.

    19. Indicar las proporciones genotípicas y fenotípicas de la descendencia de un hombre de grupo sanguíneo AB con una mujer heterocigótica de grupo B.

     

    21. Indicar las proporciones genotípicas y fenotípicas de la descendencia de un hombre de grupo sanguíneo B, cuya madre es de grupo 0, con una mujer de grupo A, cuyo padre es de grupo B.

    23. Mendel cruzó plantas homocigóticas de semillas verdes y rugosas con plantas homocigóticas de semillas amarillas y lisas, y obtuvo una F1 homogénea de semillas amarillas y lisas.
    La autofecundación de la F1 originaba los tipos parentales, y plantas con ¡nuevas características! (de semillas amarillas y rugosas, y de semillas verdes y lisas) y unas proporciones fenotípicas de 9,3,3,1.
    Realizar el cruzamiento correspondiente para explicar la razón matemática encontrada por Mendel.

    26. Se cruza una planta de tomate dihíbrida de pulpa roja y tamaño normal, con otra tomatera de pulpa amarilla y tamaño normal y se obtienen: 30 plantas rojas normales, 31 amarillas normales, 9 rojas enanas y 10 amarillas enanas.
    Indicar los genotipos de las plantas que se cruzan y realizar el cruzamiento correspondiente.
    ¿Qué proporción de tomates rojos de la descendencia serán enanos?

    29. Si consideramos que en las personas el factor Rh está regulado por dos alelos, uno dominante que determina el fenotipo Rh+ y otro recesivo, responsable del fenotipo Rh-, y que la braquidactilia, dedos anormalmente cortos, es debida a un gen dominante respecto a su alelo recesivo que determina dedos normales, indicar qué porcentaje se espera que sean Rh+ y braquidactílicos de la descendencia de una mujer Rh + y con dedos normales, hija de un hombre Rh-, y un hombre Rh- braquidactílico homocigótico para ambas características. Realizar el cruzamiento correspondiente.

    35. Indicar proporciones genotípicas y fenotípicas de la descendencia de un hombre de grupo sanguíneo 0 Rh negativo con una mujer dihíbrida de grupo A Rh positivo.

     

     

     

    43. Teniendo en cuenta que la hemofilia está provocada por un alelo recesivo ligado al cromosoma X ¿cuál será́ la proporción de hemofílicos en la descendencia de un matrimonio formado por una mujer normal cuyo padre era hemofílico y un hombre normal cuyo padre también era hemofílico?

     

     

    44. Teniendo en cuenta que el daltonismo está provocado por un alelo recesivo ligado al cromosoma X ¿qué proporción genotípica y fenotípica cabe esperar en la descendencia de un hombre daltónico con una mujer portadora del daltonismo? Si esta pareja tiene seis hijos ¿qué proporción esperamos que sean daltónicos?

    45. La distrofia muscular de Duchenne es una enfermedad mortal ligada al cromosoma X que está provocada por un alelo recesivo. La variante agresiva de la enfermedad genera atrofia muscular que provoca invalidez en la infancia y muerte prematura.
    Indicar proporciones genotípicas y fenotípicas de la descendencia de una mujer normal portadora de la enfermedad y un hombre normal.

    50. Indicar los genotipos de estas dos familias:
    a) mujer daltónica y hemofílica cuya madre no era daltónica ni hemofílica y cuyo padre era hemofílico daltónico.
    b) hombre daltónico no hemofílico cuya madre era normal pero portadora del daltonismo y de la hemofilia y cuyo padre era hemofílico daltónico.

    55. El siguiente árbol genealógico de una familia refleja que miembros (en negro) padecen una determinada enfermedad hemolítica. Teniendo en cuenta que se trata de una enfermedad genética autosómica, determinar si el alelo que provoca la enfermedad es dominante o recesivo.   

     

     

    Los hombres se representan mediante cuadrados.
    Las mujeres se representan mediante círculos.
    Cuadrados y círculos rellenos de negro indican que esos individuos padecen la enfermedad o presentan la característica que se está analizando.
    Los padres se unen por una línea horizontal, de la que parten líneas verticales a los descendientes. Los hermanos quedan conectados por una línea horizontal.
    Cada generación se representa por números romanos (de arriba a abajo.); los individuos de cada generación por números arábigos (de izquierda a derecha).

    62. La siguiente genealogía muestra los miembros hemofílicos de una determinada familia a lo largo de tres generaciones.
    a) Indica los genotipos de toda la saga familiar.
    b) ¿Qué personas han transmitido la hemofilia a los hombres de la generación III?
    c) Indicar cómo podrían aparecer mujeres hemofílicas en la generación V.




    LIBRO DE GENÉTICA FRANCISCO BUENO

    CON SOLUCIONES

     





     



    Semana